WebFlorida Surgeon General Dr. Joseph Ladapo claims the Biden administration is limiting monoclonal antibody treatments against COVID-19. According to Ladapo, the reduction … WebMar 19, 2024 · The Flp recombinases (Flp, Flpe, and Flpo) bind and cleave DNA Frt sites. We created a transgenic mouse strain ( [Fsp1-Flpo]) expressing the Flpo recombinase in fibroblasts. This strain was...
px330_DBH-p2a-FLPo vector map and sequence
Webflp recombinase Alt name EFS promoter driving FlpO recombinase Insert Size (bp) 212 Entrez Gene flp Promoter EF1a/EFS promoter inserted Cloning Information Cloning method Restriction Enzyme 5′ cloning site SnaI (destroyed during cloning) 3′ cloning site XbaI (not destroyed) 5′ sequencing primer ccagtacatgaccttatggg WebBackbone manufacturer Allen Institute Vector type AAV Growth in Bacteria Bacterial Resistance (s) Ampicillin, 100 μg/mL Growth Temperature 37°C Growth Strain (s) NEB Stable Copy number High Copy Gene/Insert Gene/Insert name FlpO Species Synthetic Insert Size (bp) 1296 Promoter Beta Globin minimal promoter Cloning Information bit shoots
Generation of a conditional Flpo/FRT mouse model expressing
WebGrowth in Bacteria Bacterial Resistance (s) Ampicillin, 100 μg/mL Growth Temperature 37°C Growth Strain (s) DH5alpha Copy number High Copy Gene/Insert Gene/Insert name FlpO-2A-Cre Species S. cerevisiae … WebAnti-Glutamate Receptor 2 Antibody, extracellular, clone 6C4 detects level of Glutamate Receptor 2 & has been published & validated for use in ELISA, IC, IH, IP, RIA & WB with … WebFlp recombinase Use Cre/Lox, Lentiviral, and RNAi Tags Expression Mammalian Mutation Promoter Availability Academic Institutions and Nonprofits only Enlarge pCAG-FlpO Plasmid #89574 Purpose Expresses FlpO under pCAG Depositor Wilson Wong Article Weinberg et al Nat Biotechnol. 2024 Mar 27. doi: 10.103 Insert FlpO Use Cre/Lox and Synthetic Biology bit shoot sherry ray